Intriguingly, we found that nematocytes were connected through neurite-like processes which formed local networks (Fig. 22,23 Urchin and starfish spine wounds should initially be treated with hot water immersion (120F/50C) for 30-60 min as tolerated or until pain dissipates. 2aIIIaIV; Fig. (n=2 complete volume capsules images from 350 capsules visible in 2 primary polyp samples. Based on still images and movies, shaft eversion occurs after complete ejection of the shaft. Together with minicollagens, the nematocysts of Hydra and Nematostella contain glycans and show similarities to the extracellular matrix in composition44,45,46,47,48. 14, 205 (2014). Reft, A. J. In Fig. Article Sakes, A. et al. PubMed 285, 2561325623 (2010). Glycobiology 17, 886894 (2007). What Triggers Nematocysts To Fire? - Caniry The connectors might function in the initiation of eversion; stretching of the capsule-shaft connector utilizes energy from the discharge to initiate shaft eversion, while the shaft-tubule connector transfers the elastic energy of the slingshot to initiate tubule eversion. Mar. Sci. In this article, we described the 3D organization of the nematocyst and the sequence of geometric transformations that occur upon its activation. In contrast, fluorescent WGA labeling was enriched in the interior, surrounding the wall structure. The presence of lymph node disease in cancer patients correlates with a poorer prognosis and dictates in part the course of treatment (1-5).However, there is a robust ongoing debate about the role of lymph node metastasis in further progression of disease (6, 7). A shellfish structure that looks like a meal attracts erstwhile predators, which then become unwitting nannies and bus drivers for the sedentary animals offspring. TRITC treated primary polyps were frozen in liquid nitrogen, thawed, and macerated manually with a plastic pestle. We are thankful to Suat Ozbek, Heidelberg University, for the minicollagen Ncol4 antibody and Ruohan Zhong for help in generating the transgenic animals. A nematocyst consists of a capsule containing a coiled tubule. 2fI, fII). The distal shaft carries the stylet apparatus, which contains three huge stylets and three arrays of thinner spines. Within this subphylum, Class Scyphozoa (cup animals) include true jellyfish that have a thick, gelatinous body and live their adult lives as medusa. CAS c Longitudinal section of a discharged capsule during shaft eversion. They do so by bringing solutes (such as salts) into their cells, which causes them to draw inwater. The arrows indicate the forward movement of the shaft. TRITC labeled nematocysts were discharged in vivo and frames were captured at 5 milliseconds intervals. 2aIIaIV, arrows; Supplementary Movie5). Often, modifications in pressure within a living system are created by water, although air can also be a source. Biol. Considering the presence of lectins in the structure, we hypothesized that the presence of GAGs could be detected with fluorescently labeled sugar-binding lectins. The stinging organelles of jellyfish, sea anemones, and other cnidarians, known as nematocysts, are remarkable cellular weapons used for both predation and defense. SEM and fluorescent images revealed differences in composition and structure between the triple-helical fibrous shaft and the smooth cylindrical tubule (Fig. This observation suggests that v1g243188 is a component of the thread that plays a role in its structural integrity but not its operation. Our analysis reveals the complex structure and the sophisticated biomechanical transformations underpinning the operational mechanism of nematocysts. Fluid Dynamics of Ballistic Strategies in Nematocyst Firing - MDPI 20, 265271 (1980). 2e) was done in Fiji (ImageJ)63. After several additional washes in PBST (0.1% Tween 20 in PBS, pH 7.4), the polyps were first blocked for 1h and incubated over night at 4C with NvNCol-4 (1:500) in PBST supplemented with 10% goat serum. 2c, arrow) with the uneverted shaft moving forward inside the connector (Fig. Nematocysts are the fastest-known accelerating structures in the animal world. Some organisms solve this challenge with only microscopic cellular components. When insects enter the tube seeking nectar, they lose their footing and slide inside, unable to climb out and escape being eaten and digested by theplant. We found that the compressed shaft consisted of tightly coiled filaments vertically aligned to the capsule aperture formed by the apical flaps (Fig. The fluorescent dye stained the animals without any apparent toxicity up to 25M concentration tested in this study. http://www.stowers.org/research/publications/libpb-1684, Description of Additional Supplementary Files, http://creativecommons.org/licenses/by/4.0/, Functional analysis in a model sea anemone reveals phylogenetic complexity and a role in cnidocyte discharge of DEG/ENaC ion channels, Single-cell atavism reveals an ancient mechanism of cell type diversification in a sea anemone. The driving force for discharge is an extreme osmotic pressure of 150 bar. But just as one living system must capture its prey to survive, its prey must escape to survive. Watson, G. M. & Hessinger, D. A. Cnidocyte mechanoreceptors are tuned to the movements of swimming prey by chemoreceptors. A switch in disulfide linkage during minicollagen assembly in Hydra nematocysts or how to assemble a 150-bar-resistant structure. Caterpillars use stitches made with contracting silk threads to roll leaves into a tube-shaped shelter. The estimates were done in Wolfram Mathematica (12.0). Novel tools for the study of development, migration, and turnover of nematocytes (cnidarian stinging cells). Graphs were generated and statistical analyses were performed using GraphPad Prism (9.3.1). Sci. The two digestive system structures that appeared first in cnidarians was stomachs and mouth. Brightness was adjusted to visualize the v1g243188 threads. Figure3a is a representative SEM image of partially discharged threads (n=6). Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. PubMed The polyps were transferred to a glass slide and mounted on a glass slide with ProLong Glass antifade mounting medium (ThermoFisher, Cat. PubMed Central David, C. et al. ADS Hydra spinalin is a glycine- and histidine-rich protein present in the spine structures on the surface of the shaft in Hydra nematocysts51,52. Tissue Cell 21, 1724 (1989). A double-walled structure is formed (Fig. Arrows indicate the direction of the forces applied to the apex of the compressed shaft filaments. Tardent, P. The cnidarian cnidocyte, a hightech cellular weaponry. For the EM micrographs in Figs. Genikhovich, G. & Technau, U. The selectivity for nematocysts we find in B. stephanieae, however, may be due to the more defensive (and offensive) function of nematocysts in cnidarians. Mechanism and structure. Renfer, E. & Technau, U. Meganuclease-assisted generation of stable transgenics in the sea anemone Nematostella vectensis. fIII Cross-section of the everted shaft (ES) and the traversing uneverted tubule (UT). Reft, A. J., Westfall, J. The process is repeated until the tubule is fully elongated or reaches an obstacle (Supplementary Movies10, 11). Movement and storage of nematocysts across development in the 1aI). Ozbek, S., Engel, U. Super-resolution fluorescence confocal images were acquired using the Zeiss LSM780 in Airyscan mode. Biol. 4, 150158 (2011). Cnidocytes contain specific organelles named nematocysts that are used for self-defense and prey capturing. Protoc. Park, S. et al. PubMed J. R. Soc. Canadienne De. Commun. Can. At the end of morphogenesis the capsule is maximally expanded and during discharge the volume gets suddenly reduced again by about 50%The high osmotic pressure is generated by poly--glutamate andanionsThey are responsible for the generation and regulation of an internal osmotic pressure that amounts up to 150 bara high osmotic pressure inside the capsule is the basic principle of all nematocysts. (zbek et al. 18, 1160 (2017). Due to the speed and complexity of these events, the precise stages of discharge and eversion have thus far remained elusive. In the meantime, to ensure continued support, we are displaying the site without styles In Fig. Renfer, E., Amon-Hassenzahl, A., Steinmetz, P. R. & Technau, U. Biol. We are indebted to Molly Simmons for the illustrations of the model. Carre, D. Hypotse sur le mcanisme de lvagination du filament urticant des cnidocystes. This suggests that the dye specifically accumulates in invaginated parts of the thread inside the capsule. 5a, arrows). As fast as a rifle shooting. FEBS J. Aerne, B., Stidwill, R. & Tardent, P. Nematocyst discharge in Hydra does not require the presence of nerve cells. 2c, blue). Thus, we postulate that the connector accumulates maximal elastic stress when the ejected shaft reaches its maximal distance from the capsule (Fig. Corresponding EM cross-sections: fI Cross-section of the tubule. Fibrous mini-collagens in Hydra nematocysts. The loose shaft-tubule connector rapidly forms a cylindrical tube which might act as a buffer zone for the transition of the three-filament shaft to the twisted tubule. CAS The externally-oriented side of a cnidocyst cell also has a hair-like trigger on it. 2c, dashed arrow). Biol. - J. Exp Zool. At the cellular level, nematocyst discharge is among the fastest mechanical processes in nature, known to be completed within 3 milliseconds in Hydra nematocysts11,12. Electroporated animals were dissolved in TRIzol Reagent (Ambion, Ref: 15596018; Lot # 254707 and RNA was extracted using the Direct-zol RNA Mini Prep Plus kit (Zymo Research, Cat. 3g, dashed boxes). This causes molecular rearrangement of the opeculum allowing the release of the nematocysts stored pressure towards the outside of the organism. wrote the manuscript. 2g and h, the discharge sequence was reconstructed from the representative images of partially discharged threads (n=67 partially discharged threads from primary polyp tentacles, three experiments). 1a, dashed arrows). Cell Biol. Original data underlying this manuscript can be accessed from the Stowers Original Data Repository (ODR) at: http://www.stowers.org/research/publications/libpb-1684. The labeled tentacles with partially discharged nematocysts were imaged either intact or crushed with the cover slide to detach the capsules from the tissue. Nematocysts are used by organisms for prey capture and feeding, but also for defense, transport, digestion and other various functions [3,4]. Importantly, we observed that TRITC labeling overlapped with the shaft filaments in the transillumination channel, suggesting that the shaft fibers harbor TRITC labeled material (Supplementary Fig. It has been shown that hydration of ruptured capsules results in extrusion and untwisting of the tubule without undergoing eversion, suggesting that the twisted tubule stores elastic energy to be later transferred into kinetic energy by acting as a spring that is released by relaxation to a cylindrical state19,20. Live imaging of transgenic primary polyps showed that the tentacles were heavily populated with EGFP+ nematocytes bearing the long form basitrichs (Fig. Further, this study will provide insight into the form and function of related cnidarian organelles and serve as a template for the design of bioinspired microdevices. Sebe-Pedros, A. et al. The structure of the shaft of the anthozoan nematocysts exhibits a staggered lamellar structure that differs from the specialized Hydra stenoteles which exhibit an arrowhead-like collocated stylet3,17,56,57. Bull. Upon incubation for 30min, 1g/ml Wheat germ agglutinin conjugated with OregonGreen (dilution 1:500, Invitrogen, Cat. Based on these observations, we defined three principal phases of nematocyst operation: shaft discharge (Phase I), shaft eversion (Phase II), and tubule eversion (Phase III; Fig. CAS In tentacle tips, developing capsules deep inside the ectoderm stained with Ncol4 antibody while fully matured capsules lining the surface of the tentacle epithelium were not stained (Supplementary Figs. Nematocysts are explosive cellular structures that fire a tiny barbed harpoon into predators and prey and inject a painful and paralyzing cocktail of chemicals. 1d, e and 2be, serial sections from two different animals were acquired. Biol. Further information on research design is available in theNature Research Reporting Summary linked to this article. The arrow points to the network of cellular processes connecting nematocytes. In Supplementary Fig. This protein is thought to act as a substrate for the assembly of other structural proteins into the thread, thus its temporal expression defines a useful window for visualizing nematocytes30. #: M3003L, Lot #: 10133023) using the following primers (Integrated DNA Technologies): Quantitative RT-PCR data was analyzed as previously described64. For many living systems, modifying pressure provides extra strength. Corresponding 3D reconstruction of the longitudinal section shows the capsule, central shaft (blue), a portion of the attached tubule (magenta), connector regions (yellow), and apical flaps (dashed box). The cnidocyst is the defining organelle of the cnidarians, used for capture of prey and defensenematocysts comprise a powerful molecular spring mechanism releasing energy stored in the wall polymer in the nanosecond time rangeThe nematocyst is product of a giant post-Golgi vesicleIt consists of several different protein species that assemble into a large capsular structure with a long spiny tubule inside. Arrow indicates kinking at a distal tubule site. Internet Explorer). 3a, b). Samples were cured for 48h at 60C and serial sections were cut at 50nm using a Diatome 45-degree ultra-diamond knife or an AT-4 35-degree diamond knife on a Leica UC7 ultramicrotome. On triggering, the cyst extrudes this tubule in an extremely rapid manner. Each sample was analyzed in triplicate. Lymph node metastases can invade local blood vessels, exit the node and The mixture is allowed to settle on ice for 30min and centrifuged for 15min at 950g. The pellet is washed twice with PBS with 0.01% Tween-20) resuspended in nematocyst discharge buffer (10mM Tris, pH 7.5, 10mM CaCl2). Spawning induction and de-jellying were carried out as previously described58. Name and describe the two different versions of the cnidarian body plan. g A fully everted thread labeled with TRITC and WGA (n=15 purified and discharged threads). Analysis of soluble protein contents from the nematocysts of a model sea anemone sheds light on venom evolution. A muscle-specific transgenic reporter line of the sea anemone, Nematostella vectensis. R. Soc. Nematocyst - an overview | ScienceDirect Topics Chem. We further confirmed that knockdown resulted in a two-fold reduction of Nemve1_232014 mRNA expression by qPCR, suggesting that this protein must be present in abundance for proper assembly of the thread and capsule (Supplementary Fig. We found nematocysts of various cnidarians to be acidic inside and propose that the pH difference between cyst matrix and cytoplasm . This high acceleration can explain how a small mass can generate sufficient force at the site of impact. 2, 91 (2019). c Super-resolution image of the everting tubule tip (Stage 1) (n=20 threads of a primary polyp tentacle). Physiol. The fixative was removed, and the samples were washed 5 times with 1ml PBS pH 7.4 to remove the fixative. 376, 10081020 (2008). We also suggest a model explaining the specific mechanisms of thread eversion. Sci. These results confirm a similar triplet lamellar structure to that observed in Anemonia sulcata by Godknecht and Tardent (1988), who noted the tip of the shaft is formed by staggered lamellae converging at a small area pointing towards the capsule aperture17. Minicollagen-15, a novel minicollagen isolated from Hydra, forms tubule structures in nematocysts. J. Biol. Altogether, these data indicate that shaft eversion executes a reproducible series of physical transformations that involve the uncoiling and forward motion of its filaments. This video animation from Shape of Life depicts the function of nematocysts in the tentacles of an anemone (another type of cnidarian). & Zlotkin, E. Delivery of a nematocyst toxin. Figure3e, f are representative fluorescent images acquired from partially discharged primary polyp tentacles of scramble control shRNA (n=0/25 threads from 1/27 tentacles) and v1g243188 shRNA (n=25/25 threads from 1/25 tentacles) from 5 knockdown experiments. In the undischarged state, we observed sparse lamellae decorating the region where the shaft tapered to the capsule-shaft connector (Fig. Cnidocyst structure and the biomechanics ofdischarge. Modifying speed or magnitude of velocity is important for some living systems because it enables them to control their movement to access resources, escape predators, and more. The images or other third party material in this article are included in the articles Creative Commons license, unless indicated otherwise in a credit line to the material. AAGCAACACGCAGAGTCGTAATCTCTTGAATTACGACTCTGCGTGTTGCTATAGTGAGTCGTATTA. TRITC treated primary polyps were fixed in Lavdovskis fixative (ethanolformaldehydeacetic aciddH2O; 5010436) overnight24. This force is in the range of technical bullets and explains how a 5 mm thick solid cuticle of a crustacean prey can be effectively perforated by a cnidarian nematocyst with a minimum of mass. A.K., B.R., and M.C.G. 1b). Diversity and evolution of myxozoan minicollagens and nematogalectins. Further, SEM cross-sections through the shaft showed that its filaments consisted of lamellae that enclosed the traversing uneverted tubule, as seen in fluorescent images (Fig. Weir, K., Dupre, C., van Giesen, L., Lee, A. S. & Bellono, N. W. A molecular filter for the cnidarian stinging response. The architecture and operating mechanism of a cnidarian stinging organelle, https://doi.org/10.1038/s41467-022-31090-0. Non-muscle myosin II drives critical steps of nematocyst morphogenesis 12, 18441854 (2017). The stinging organelles of jellyfish, sea anemones, and other cnidarians, known as nematocysts, are remarkable cellular weapons used for both predation and defense. The eggs were fertilized with sperm from wild-type or transgenic males. Bull. The polyps were transferred to a glass slide and mounted with ProLong Glass Antifade Mountant (ThermoFisher, Cat. Tardent, P. & Holstein, T. Morphology and morphodynamics of the stenotele nematocyst of Hydra attenuata Pall. 97, 289299 (2018). J. Microsc. Google Scholar. Article Thus, we stained discharged nematocysts with fluorescent dye-conjugated Wheat Germ Agglutinin (WGA), which is selective for GlcNAc chains, and found that WGA strongly bound to the electron-lucent thread wall (Fig. PubMed Beckmann, A. The everted capsule-shaft connector was externally covered with sparse filaments resembling irregular spines originating from the eversion of the lamellae observed in the undischarged state (Fig. Nematocysts of this species have a bulb-shaped base that connects to a narrow barbed top, from which a long thin filament extends many times the length of the nematocysts base. Cnidaria Flashcards | Quizlet Nematocyst | biology | Britannica This analysis reveals the complex biomechanical transformations underpinning the operating mechanism of nematocysts, one of natures most exquisite biological micro-machines. Interestingly, the thread wall did not incorporate TRITC and was invisible in fluorescent images but could be seen in corresponding SEM cross-sections as an electron-lucent layer that enclosed the uneverted tubule in its compacted state (Fig. Microbial arms race: Ballistic nematocysts in dinoflagellates represent a new extreme in organelle complexity. Nematocyst Stingers Accelerate Fast Biological Strategy - AskNature Koch, A. W. et al. Following in situ nematocyte stimulation, the compressed shaft was first ejected as a dense projectile which then rapidly expanded to form an elongated cylinder through which the tubule emerged (Fig. Note: The shaft eversion (Phase II) was too fast to be captured in this sequence. This thread is composed of two distinct sub-structures: a short, rigid, and fibrous shaft and a long thin tubule decorated with barbs17,22. J. Mol. 2e, arrow; Supplementary Movie9). This movement resulted in complete eversion of the three filaments where the shafts former apical end became its basal end. Scale bars 1 m. Karabulut, A., He, S., Chen, C. Y., McKinney, S. A. 5c, arrow). The length measurements for the undischarged and discharged capsules and tubules were performed manually using Fiji (ImageJ) freehand manual tracing tool and the results were discussed in Supplementary information. The images are representative of primary polyps tentacles and body columns from 6 spawns. Co-staining with WGA and TRITC showed that the WGA-stained material did not co-localize with TRITC, but rather formed a laminate with the TRITC-labeled structures. Based on our results, we conclude that nematocyst operation occurs in three stages involving a complex transformation of the shaft and the elongation of the tubule, during which energy stored in the overall structure is transformed to kinetic energy. 2b, dashed arrow). Philos. Figures3c, d were representatives of Stage 1 threads (Fig. The polyps were spread onto the glass slides. a SEM image (n=6, 2 experiments) of the shaft (arrow), tubule, and helically arranged barbs (dashed arrow). The shaft is composed of three helically coiled filaments, and is initially ejected as a compressed projectile, piercing the target, and later everts to form a lumen through which the remainder of the thread, the tubule, is released17. CAS Article USA 107, 1853918544 (2010). Eur. 2f). #: R2072). Interface 14, 20160917 (2017). Biol. The stylets are composed of a keratin-like protein and have an extremely narrow tip. J. Struct. 2b, c, TRITC, arrows; WGA, dashed arrows). In summary, this study demonstrates the operational capability of the nematocyst as a complex and self-assembling biological micromachine. USA 107, 104108 (2010). These findings allowed us to build a model describing the key aspects of the observed geometric eversion in three phases. Two nematocysts are focused on in this image. While it is known that shaft eversion entails a geometric transformation from a tightly compressed coil to a hollow syringe, the mechanisms driving this process are poorly understood. The mean signal intensity, area, and length of the objects were acquired in Fiji (ImageJ) by using a measurement tool. Spinalin, a new glycine- and histidine-rich protein in spines of Hydra nematocysts. Google Scholar. Nature Communications thanks Nicholas Money and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. Despite the broad evolutionary conservation of this embryonic stage, the cellular behaviours that lead to blastoderm formation vary across animals, and the mechanisms that regulate these behaviours are poorly understood. aII EGFP expression on the body column. 1a, arrows). Understanding the Morphology and Distribution of Nematocysts in Sea Anemones and Their Relatives. Basitrichous isorhizas capsules (n=19 short, n=20 long) with densely labeled shaft (arrow) and coiled tubule (dashed arrow) continuous with the compressed shaft (left and middle panels). 195, 145155 (1998). 448, 715 (2019). Upon incubation, the reactive dye was removed by multiple washes. The model shows the uncoiling shaft filaments and the forward movement of the shaft-tubule connector and the tubule. #:4382406, Lot # 0124432). & Fautin, D. G. Formation of the apical flaps in nematocysts of sea anemones (cnidaria: actiniaria). Proc. Induction of spawning in the starlet sea anemone Nematostella vectensis, in vitro fertilization of gametes, and dejellying of zygotes. Abstract. In sea anemones, nematocyst capsules are sealed by three apical flaps connected to the stinging thread26,27,28. Scale bars 2 m. What causes Cnidocytes to fire? The fluorescence imaging was performed using the Zeiss LSM780 in Airyscan mode. Thus, the nematocyst operates in distinct phases that involve an initial phase of piercing the target and later phases of eversion to form a lumen. Upon triggering, but prior to discharge, the capsule approximately doubles in volume due to the rapid influx of water17. After RNA extraction, cDNA was synthesized with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Cat. 2d, arrow) in which the tubule could be observed departing the capsule (Fig. Jongebloed, W. L., Stokroos, I., Van der Want, J. J. Google Scholar. We found that shRNA-mediated knockdown of the nematogalectin-like gene Nemve1_232014 resulted in abnormal capsules and prevented thread formation (Supplementary Fig. There are about 30 different types of nematocysts which can be used to ward off predators, secure prey and (sometimes) movement. 116, 7176 (1996). Comp. The stylet, composed of strong and flexible protein tubules with spiked barbs at the end, ejects from the cell with an acceleration of ~5.4 million times gravity. Adamczyk, P. et al. b Fluorescent image of a partially everted tubule. J. Structural studies of nematocyst threads penetrating gel substrates indicate that shaft eversion is initiated at the shafts apex17. The helices of the everted filaments exhibit a larger radius and step compared to their uneverted configuration. The elastic energy stored in the bands converts into kinetic energy of the accelerating projectile. 3b, Stages 1, 2; Supplementary Movie5). Indeed, as the barbs lessened distally, the tubule appeared to become more prone to kinking compared to the proximal regions which could bend in smooth curves (Fig. Note: The basal end of the uneverted shaft becomes the apical end of the everted shaft. J. Struct. Google Scholar. J. Mol. 2009:1038), Within less than 3 ms the tubule evaginates and injects toxins into the preyOn the molecular level, the nematocyst is designed to withstand this extreme mechanical stress by combining high resistance and flexibility. f A partially everted nematocyst thread revealed by TRITC incorporation showing the everted shaft (ES) filaments, the uneverted tubule (UT, center) and the barbs (B) decorating the everted portion of the tubule (ET). Here, the stenoteles represent one of the most sophisticated capsule types. Itakura, Y., Nakamura-Tsuruta, S., Kominami, J., Tateno, H. & Hirabayashi, J. Sugar-binding profiles of chitin-binding lectins from the Hevein family: A comprehensive study. Long, slippery hairs within the tube face downward. The images captured after dropwise addition of glacial acetic acid (37%) to the ASW which triggers capsule discharge when the pH sufficiently decreases in the medium below a certain threshold. 4b, c). Local density determines nuclear movements during syncytial - bioRxiv Science 265, 402404 (1994). During the early stages of discharge, the everted capsule-shaft connector formed a skirt around the traversing shaft, creating a double-walled structure (Fig. This seems to be the fastest known process generated in animal systems[prior to discharge] the cyst is in its maximally expanded state and only a minimal increase in pressure is sufficient to elicit dischargeSpinalin, a keratin-like glycine- and histidine-rich protein, is involved in the formation of spine and operculum structures. (zbek et al. 1c, arrows), in which the dye intensity was very high compared to the tubule, fluorescent TRITC incorporated with similar intensity in both the shaft and tubule of basitrichs (Fig. Watson, G. M. & Mariscal, R. N. Ultrastructure of nematocyst discharge in catch tentacles of the sea anemone Haliplanella luciae (Cnidaria: Anthozoa).